shantelbisor shantelbisor

07-06-2022
Mathematics

contestada

If y = –0.96 when x = 2.4, what is y when x = 2.9?

Respuesta :

s1706896 s1706896

07-06-2022

Answer:

It should be -1.16

Step-by-step explanation:

Hope this helps :)

Answer Link

Otras preguntas

advantages of cell phones through a moral lens

PLZ HELP ASAP!!!!!!!!!!! Is this statement true or false? Lewis Hine and Charles Sheeler made artworks about American industry. Hine made documentary photog

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of

If the theater wanted to a 60-ounce bag of popcornn, ehat would be a good price

For the sentence below, choose the correct tense of the verb to argue to ensureagreement.James ____with Theo and then slammed the door.

GIVEN BRAINLIEST + 5 STARS + THANKS Twanda highlighted the following information she found in an online article about animal intelligence: Intelligence is wides

MOST men diagnosed with erectile disorder are older than the age of _____, mainly because of its association with age-related ailments and/or diseases.

"Using a direct sequence spread spectrum (DSSS) technique spreads a narrow band channel so that it occupies greater frequency spectrum. By doing this, the signa

Johns’ statement shows a previous balance of $745.00, a payment of $425, and a new transaction of $622.00. His APR is 10.4%. What is John’s new balance? (Answer

Language, beliefs, values, norms, behavior, material objects, and technology that are passed from one generation to the next by members of society describe ____