avonnafindley6 avonnafindley6
  • 10-09-2021
  • Mathematics
contestada

$50.16 for 12 hours
per hour

Respuesta :

amitpatelrewa1 amitpatelrewa1
  • 10-09-2021

Answer:

4.18$ earn in per hour

Step-by-step explanation:

12 hour =50.16$

50.16÷12

4.18$

Answer Link

Otras preguntas

Scientists use different types of evidence to support the theory of evolution. Four types of evidence are: fossil evidence, molecular evidence, developmental ev
Who kills Henry at the end of the novel
Molecules can be made of atoms of the same element only. different elements only. the same or different elements.
Me duele que los extranjeros _______________ las costumbres y las tradiciones locales. A. desconoce B. desconozca C. desconozcan D. desconocen
What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
A 60 kilogram student jumps down from a laboratory counter. At the instant he lands on the floor hus speed is 3 meters per second. If the student stops in .2 se
Compare. Write <,>,or =. 250 lb __ 0.25 T
what is most mostly to result immediately after a rainforest in Brazil is clear -cut
how were states able to get around the newly added amendments 1 full paragraph
how is Cathy Queen of cats different from Esperanz A. Cathy is more judgemental of others B. esperanza is a better athlete C. Cathy has more friends that espera