Seudónimo Seudónimo

11-01-2021
Social Studies

contestada

How do characteristics change over time?

Respuesta :

safaa42 safaa42

11-01-2021

Answer:

adaptive and increase fitness and according to their age and abilities they do according to it

Answer Link

Otras preguntas

Normally men sweep this street every day

what role do good roads play in developing the country

There are 12 marbles in a bag. 3 are green, 4 are blue, 3 are yellow and 2 are red. One marble is picked at random. What is the probability that this marble is

You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATTGTTCGGCAAATAAAAATAA Wha

A gnat's eye is 0.012 inches wide. A fly's eye is 2.4 x 10-1 inches wide. How much larger is the fly's eye?

PLEASE HELP! What is the value of a? A 12 B. 15 C. 17:25 D. 21.25

Which of the following best shows the distributive property? 1. 2(2 - 3) = 2(-1) 2. 2(2 - 3) = 2(2) - 2(3) 3. 2 - 3 = (-3) + 2 4. 2 + (2 - 3) = (2 - 2) + 3

Four months ago, Cynthia signed up to receive email notifications to remind her to change her contact lenses, Cynthia's first email arrived 9 days after she set

What are the associated short and long term consequences of skin cancer? with Evidence to support.

True/False: The American Standard Code for Information (ASCII) is a code that allows people to read information on a computer. True False 2. The program is