2blanchardmar 2blanchardmar
  • 08-09-2014
  • Mathematics
contestada

19t=8v(q-2h) solve for q

Respuesta :

AL2006
AL2006 AL2006
  • 08-09-2014
19t = 8v(q - 2h)

Divide each side of the equation by  8v :

19t / 8v = q - 2h

Add  2h  to each side :

2h + 19t/8v = q
Answer Link

Otras preguntas

Arteries carry oxygenated blood away from the heart and typically have ________________ blood pressure. Veins carry deoxygenated blood to the heart and typicall
Julie has two formal events to go to--one for her work and one for her partner's work. She has six formal dresses--two blue ones, one black, one red, and two wh
Q #10 Solve the graph
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
Explain how Europe’s devastating fourteenth-­‐century plague outbreaks influenced the literature of Boccaccio and perhaps Chaucer.
The relative locations of a swing set, a garden, and a sandbox in Gina's backyard are shown in the diagram. What is the distance between the sandbox and garden?
Which of the following comparisons of fusion and fission is correct? A. Both fission and fusion result in products that are heavier than the reactants. B. Both
Read the following lyrics to a familiar song and answer the question below: I've got a gal in Baltimore. Little Liza Jane! Tulips grow around her door. Little L
The term that means difficulty in speaking or making a sound is:
What is the best option for your retirement plan when you leave a company?