07-03-2024
Mathematics

contestada

JKL with J(2, 4), K(4, 2), L(0, -4) with a scale factor of 2. Then with a scale factor of 1/2.

Respuesta :

Otras preguntas

Jose worked n hours at $8.75 per hour.He made a total of $61.25. Write an expression that represents the total number of hours Jose worked. SHOW yoUR WORK PLEAS

what is 3000+737563÷95

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Which action best demonstrated the united states effort to isolate itself from european conflicts after world war i?

Which number is the largest-10; -5; -1/2 (-0.50) -1/3 (-0.33)

All languages are created from the same set of phonemes. a. True b. False

Select the best deal for tutoring help for your Algebra I class. A) $45 for 1 hour B) all the same rate C) $30 for 50 minutes D) $20 for 30 minutes HURRY 20

Read the following and answer the question that follows: “Look out!” cried Mary, “You are about to step on a snake!” “Thanks, Mary,” replied Jane. “That was a c

Enantiomers are molecules that show handedness and contain at least one chiral carbon. a chiral carbon has ________ different group(s) attached to it.

name the 6 kingdom and give an example of each