hannahbrown6708 hannahbrown6708
  • 09-02-2024
  • Mathematics
contestada

A = {7, 8, 9, 11} B = {7, 8, 9, 11}
B⊆A
a. True
b. False

Respuesta :

Otras preguntas

The average sedentary individual's resting heart rate is 105 beats per minute (bpm). true or false
When an antibody binds to a toxin, the resulting action is referred to as neutralization adcc agglutination opsonization?
The given figure shows the shadow of a tower at midday. In which of these countries is the tower POSSIBLY located? A) Argentina B) Australia C) Brazil D) Ca
The mass of a grain of sand is about 10^-3 gram. About how many grains of sand are in a 10kg bag of sand?
Simplify 2√36 (show work)
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
What is (x-5)1/2+5=2
In an effort to control a total institution and to create a community of sameness, inmates are forced to strip down, be searched by police officers, and given i
McCune Landscaping buys 100 shovels for $15 each. McCune sells all 100 shovels at $29.99. What is the profit?
In two or more complete sentences, compare the number of x-intercepts in the graph of f(x) = x^2 to the number of x-intercepts in the graph of g(x) = -x^2 -5. B