santy012710 santy012710

07-06-2023
Social Studies

contestada

¿Qué factores contribuyeron al fuerte crecimiento natural que acompañó la revolución Industrialn

Respuesta :

Otras preguntas

After the U.S. launched a near-total trade embargo on Cuba in 1960, and the two nations formally ended diplomatic relations in January 1961, what U.S. agency re

What does carrying capacity mean? A. the maximum number of reproducing members in a population B. when growth rate start to decrease C. when growth rate level

Josefina is the only seller of sopapillas in town. Last week, she sold 200 sopapillas, and the marginal revenue of the 200th sopapilla was $1.50 and the margina

A sixth grade class of 295 students is having an end of the year laser tag party. The party will cost $8.95 per student, but since so many students are attendi

Q 1: A pilot is flying a small plane at 30.0 m/s in a circular path with a radius of 100.0 m. If a centripetal force of 635N is needed to maintain the pilot’s c

The sunflower species Helianthus anomalus is thought to have been formed by hybridization between the sunflower species H. petiolaris and H. annuus because it c

A jug of juice hold 8 cups. Convert 8 cups to pints.

Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5 ′ − GGCCCUUUUAGGGCCAAAAA − 3 ′ a sequence of uracil–ade

It is possible to determine the ionization energy for hydrogen using the Bohr equation. Calculate the ionization energy for an atom of hydrogen, making the assu

what is greater? -2.5 or -1.75